The detailed information of tRNA gene sequence


Sequence ID>W1810192267
Genome IDPKLZ01000001
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesChromatocurvus sp. F02 (PKLZ)
Start position on genome 322916
End posion on genome 322841
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
cgttctttca
tRNA gene sequence
GGGCCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGCTGGTTCGAAT
CCAGCACGGCCCACCA
Downstream region at tRNA end position
tacaagcaaa
Secondary structure (Cloverleaf model)
>W1810192267	Lys	TTT
                   a      ACCA tacaagcaaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     T - A          T A
                    T     C G A C C     A
      T G A        A      | | | | |     G
    T       C T C G       G C T G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     TGGTC
                    G + T
                    T - A
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK