The detailed information of tRNA gene sequence


Sequence ID>W1810195552
Genome IDPKRQ01000002
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesTabrizicola sp. TH137 (PKRQ)
Start position on genome 242529
End posion on genome 242456
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
cagccccgtc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
gccccacccc
Secondary structure (Cloverleaf model)
>W1810195552	Gly	CCC
                   c      TCCA gccccacccc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK