The detailed information of tRNA gene sequence


Sequence ID>W1810197037
Genome IDPNFP01000016
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesEnsifer adhaerens ST2 (PNFP)
Start position on genome 18405
End posion on genome 18501
Amino Acid Sec
Anticodon TCA
Upstream region at tRNA start position
ttcacgctgA
tRNA gene sequence
GGAAGGGAATCGTCTCCGGTGGGACGGCCGGACTTCAAATCCGGTTGGGGCAGCGAGCCT
GTCCCGGGTGGGTTCGACCCCCACTCCCCTCCGCC
Downstream region at tRNA end position
Agtgctcgcg
Secondary structure (Cloverleaf model)
>W1810197037	Sec	TCA
                   A      CGCC Agtgctcgcg
                     G - C
                     G + T
                     A   C
                     A   C
                     G - C
                     G - C
                     G + T          C C
                    A     C A C C C     A
      C T C        A      | | | | |     G
    C       T G C T       G T G G G     C
    G       +     +                 T T
    G       G A C G
      T G G        G     TTGGGGCAGCGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK