The detailed information of tRNA gene sequence


Sequence ID>W1810226400
Genome IDPOWL01000001
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea sp. ICBG 1758 (POWL)
Start position on genome 1777551
End posion on genome 1777625
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gtttccggat
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
cagacatctc
Secondary structure (Cloverleaf model)
>W1810226400	Arg	CCT
                   t      ACCA cagacatctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK