The detailed information of tRNA gene sequence


Sequence ID>W1810226489
Genome IDPOWM01000002
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea sp. ICBG 985 (POWM)
Start position on genome 48373
End posion on genome 48301
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cgcgccgcac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACtt
Downstream region at tRNA end position
tttgcaagtc
Secondary structure (Cloverleaf model)
>W1810226489	Arg	CCT
                   c      ACtt tttgcaagtc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK