The detailed information of tRNA gene sequence


Sequence ID>W1810226570
Genome IDPOWN01000005
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea sp. ICBG 828 (POWN)
Start position on genome 231085
End posion on genome 231159
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cgcgccgcac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
gtaacagctc
Secondary structure (Cloverleaf model)
>W1810226570	Arg	CCT
                   c      ACCA gtaacagctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK