The detailed information of tRNA gene sequence


Sequence ID>W1810235992
Genome IDPPGA01000008
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans ISTOD1 (PPGA)
Start position on genome 121564
End posion on genome 121469
Amino Acid Sec
Anticodon TCA
Upstream region at tRNA start position
tcggggatag
tRNA gene sequence
GGAAGAGAAGCGTCCCCGGTGGGGCGGCCGGACTTCAAATCCGGTTGGGGCAGTGAGCCT
GTCCCGGGTGGGTTCGACTCCCACTCTCTTCCGCCA
Downstream region at tRNA end position
gatgcgacga
Secondary structure (Cloverleaf model)
>W1810235992	Sec	TCA
                   g      GCCA gatgcgacga
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T C
                    A     C A C C C     A
      C C C        G      | | | | |     G
    G       C T G C       G T G G G     C
    G       | + | |                 T T
    T       G G C G
      G G          G     TTGGGGCAGTGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK