The detailed information of tRNA gene sequence


Sequence ID>W1810235996
Genome IDPPGA01000013
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans ISTOD1 (PPGA)
Start position on genome 57865
End posion on genome 57950
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
caatcccggc
tRNA gene sequence
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC
GGGTTCGAGTCCCGCCGCCCGCACCA
Downstream region at tRNA end position
agaccccaag
Secondary structure (Cloverleaf model)
>W1810235996	Leu	TAA
                   c      ACCA agaccccaag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G C G       G C G G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     GGGGCGCAAGCCTGT
                    T   T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK