The detailed information of tRNA gene sequence


Sequence ID>W1810296338
Genome IDPTJF01000021
Search identical group
Phylum/ClassBacteroidetes
SpeciesParapedobacter indicus RK1 (PTJF)
Start position on genome 3445
End posion on genome 3371
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
aaggcaagct
tRNA gene sequence
AGTCCCGTAGCTCAGTTGGTTAGAGCACTACACTGATAATGTAGGGGTCAGCAGTTCAAG
TCTGCTCGGGACTACgg
Downstream region at tRNA end position
agaagagggg
Secondary structure (Cloverleaf model)
>W1810296338	Ile	GAT
                   t      ACgg agaagagggg
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     T C G T C     A
      T G A        A      | | | | |     A
    T       C T C G       A G C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK