The detailed information of tRNA gene sequence


Sequence ID>W1810326558
Genome IDPUGC01000011
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea ananatis ARC310 (PUGC)
Start position on genome 22330
End posion on genome 22404
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ctgcgctggc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
aatgctaatc
Secondary structure (Cloverleaf model)
>W1810326558	Arg	CCT
                   c      ACCA aatgctaatc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK