The detailed information of tRNA gene sequence


Sequence ID>W1810326626
Genome IDPUGD01000001
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea ananatis ARC272 (PUGD)
Start position on genome 183986
End posion on genome 183912
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ctgcgcaggc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tgtatgcctc
Secondary structure (Cloverleaf model)
>W1810326626	Arg	CCT
                   c      ACCA tgtatgcctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK