The detailed information of tRNA gene sequence


Sequence ID>W1810364368
Genome IDPVTE01000005
Search identical group
Phylum/ClassBacteroidetes
SpeciesSpirosoma oryzae DSM 28354 (PVTE)
Start position on genome 75519
End posion on genome 75445
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ttaaagaatt
tRNA gene sequence
GGTTGCGTAGTTCAACGGATAGAATAGACGTTTCCTAAACGTTTGATATGGGTTCGATTC
CCGTCGCGACCACCA
Downstream region at tRNA end position
ctactgtaaa
Secondary structure (Cloverleaf model)
>W1810364368	Arg	CCT
                   t      ACCA ctactgtaaa
                     G - C
                     G - C
                     T - A
                     T + G
                     G - C
                     C - G
                     G - C          T T
                    T     T G C C C     A
      C A A        A      | + | | |     G
    G       C T T G       A T G G G     C
    G       | | | +                 T T
    A       G A A T
      T A          A     TGAT
                    G + T
                    A - T
                    C - G
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK