The detailed information of tRNA gene sequence


Sequence ID>W1810365197
Genome IDPVTX01000001
Search identical group
Phylum/ClassActinobacteria
SpeciesIsoptericola halotolerans CG 23 (PVTX)
Start position on genome 303152
End posion on genome 303081
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggacgatcgt
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCtc
Downstream region at tRNA end position
cagtgaatgt
Secondary structure (Cloverleaf model)
>W1810365197	Gly	CCC
                   t      TCtc cagtgaatgt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK