The detailed information of tRNA gene sequence


Sequence ID>W1810365317
Genome IDPVTZ01000012
Search identical group
Phylum/ClassFirmicutes
SpeciesLaceyella sediminis RHA1 (PVTZ)
Start position on genome 54779
End posion on genome 54854
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
aattgaatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCACCA
Downstream region at tRNA end position
cacggtttaa
Secondary structure (Cloverleaf model)
>W1810365317	Ala	GGC
                   c      ACCA cacggtttaa
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK