The detailed information of tRNA gene sequence


Sequence ID>W1810387027
Genome IDPXVC01000020
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus lacustris Tous (PXVC)
Start position on genome 12941
End posion on genome 12870
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
ccatccacac
tRNA gene sequence
GCCCTTGTAGCTCAGCGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCACGAGTTCAATTC
TCGTCAAGGGCTttt
Downstream region at tRNA end position
aagttnaaat
Secondary structure (Cloverleaf model)
>W1810387027	Thr	GGT
                   c      Tttt aagttnaaat
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     T - A
                     G - C          T T
                    T     T G C T C     A
        G A        A      | | | | |     A
      C     C T C G       A C G A G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     AGGTC
                    C - G
                    T - A
                    C - G
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK