The detailed information of tRNA gene sequence


Sequence ID>W1810463507
Genome IDPZZP01000001
Search identical group
Phylum/ClassFirmicutes
SpeciesDesmospora activa DSM 45169 (PZZP)
Start position on genome 1887203
End posion on genome 1887128
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
taaaaaatag
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCACCA
Downstream region at tRNA end position
ccaaaaacct
Secondary structure (Cloverleaf model)
>W1810463507	Ala	GGC
                   g      ACCA ccaaaaacct
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK