The detailed information of tRNA gene sequence


Sequence ID>W1810463735
Genome IDPZZU01000015
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesNovosphingobium sp. GV064 (PZZU)
Start position on genome 58025
End posion on genome 57949
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
gcggacctgg
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
cttttcctga
Secondary structure (Cloverleaf model)
>W1810463735	Met	CAT
                   g      ACCA cttttcctga
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK