The detailed information of tRNA gene sequence


Sequence ID>W1810475354
Genome IDQAIY01002339
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPseudomonas sp. HMWF031 (QAIY)
Start position on genome 139
End posion on genome 220
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
cgtcgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ctcttctccc
Secondary structure (Cloverleaf model)
>W1810475354	Leu	GAG
                   c      Attt ctcttctccc
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK