The detailed information of tRNA gene sequence


Sequence ID>W1810476701
Genome IDQAOF01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. PP-CE-3G-477 (QAOF)
Start position on genome 774846
End posion on genome 774770
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcccgccagt
tRNA gene sequence
GCCCCCGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGCCGCGTGTTCAAA
TCTCGCCGGGGGCACCA
Downstream region at tRNA end position
ccacgcctaa
Secondary structure (Cloverleaf model)
>W1810476701	Arg	CCT
                   t      ACCA ccacgcctaa
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C T C     A
      C G A        A      | | |   |     A
    C       C T C G       G C G T G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGCC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK