The detailed information of tRNA gene sequence


Sequence ID>W1810477864
Genome IDQAPD01000070
Search identical group
Phylum/ClassActinobacteria
SpeciesSphaerisporangium cinnabarinum ATCC 31213 (QAPD)
Start position on genome 9751
End posion on genome 9822
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ccggcgccgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCag
Downstream region at tRNA end position
ccttcgagag
Secondary structure (Cloverleaf model)
>W1810477864	Gly	CCC
                   c      TCag ccttcgagag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK