The detailed information of tRNA gene sequence


Sequence ID>W1810486242
Genome IDQAXT01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesRhodobacter aestuarii JA296 (QAXT)
Start position on genome 459064
End posion on genome 459137
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gggcgctcat
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
tcccatccga
Secondary structure (Cloverleaf model)
>W1810486242	Gly	CCC
                   t      TCCA tcccatccga
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK