The detailed information of tRNA gene sequence


Sequence ID>W1810514186
Genome IDQBUG01000003
Search identical group
Phylum/ClassActinobacteria
SpeciesPromicromonospora sp. AC04 (QBUG)
Start position on genome 27464
End posion on genome 27537
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
accggacgat
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCA
Downstream region at tRNA end position
gcaagaacgc
Secondary structure (Cloverleaf model)
>W1810514186	Gly	CCC
                   t      TCCA gcaagaacgc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK