The detailed information of tRNA gene sequence


Sequence ID>W1810523089
Genome IDQCKD01000013
Search identical group
Phylum/ClassCyanobacteria
SpeciesProchlorococcus sp. AG-409-J23 (QCKD)
Start position on genome 12728
End posion on genome 12818
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ctagatcatT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTat
Downstream region at tRNA end position
ttaaactcat
Secondary structure (Cloverleaf model)
>W1810523089	Ser	GCT
                   T      GTat ttaaactcat
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK