The detailed information of tRNA gene sequence


Sequence ID>W1810524723
Genome IDQCMM01000002
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. AG-420-M02 (QCMM)
Start position on genome 2984
End posion on genome 2913
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
tccgccacat
tRNA gene sequence
GCCCTTGTAGCTCAGCGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCACGAGTTCAATTC
TCGTCAAGGGCTtca
Downstream region at tRNA end position
tcttccaggt
Secondary structure (Cloverleaf model)
>W1810524723	Thr	GGT
                   t      Ttca tcttccaggt
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     T - A
                     G - C          T T
                    T     T G C T C     A
        G A        A      | | | | |     A
      C     C T C G       A C G A G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     AGGTC
                    C - G
                    T - A
                    C - G
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK