The detailed information of tRNA gene sequence


Sequence ID>W1810530064
Genome IDQCVQ01000045
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. AG-686-F08 (QCVQ)
Start position on genome 903
End posion on genome 813
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ttttgctgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtt
Downstream region at tRNA end position
taaacaagtc
Secondary structure (Cloverleaf model)
>W1810530064	Ser	GCT
                   T      GTtt taaacaagtc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK