The detailed information of tRNA gene sequence


Sequence ID>W1810585317
Genome IDQFCQ01000033
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus thiocyanatus SST (QFCQ)
Start position on genome 1406
End posion on genome 1479
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggcgggcgtc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
accatccgca
Secondary structure (Cloverleaf model)
>W1810585317	Gly	CCC
                   c      TCCA accatccgca
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK