The detailed information of tRNA gene sequence


Sequence ID>W1810597663
Genome IDQGHN01000005
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus sp. SUBG0010 (QGHN)
Start position on genome 346439
End posion on genome 346511
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
tcaaatatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtct
Downstream region at tRNA end position
tgcgaataaa
Secondary structure (Cloverleaf model)
>W1810597663	Ala	GGC
                   c      Atct tgcgaataaa
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK