The detailed information of tRNA gene sequence


Sequence ID>W1810671979
Genome IDQJTB01000003
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesEnsifer adhaerens WJB133 25_10 (QJTB)
Start position on genome 305616
End posion on genome 305712
Amino Acid Sec
Anticodon TCA
Upstream region at tRNA start position
tgcgcgctgA
tRNA gene sequence
GGAAGGGAATCGTCTCCGGTGGGACGGCCGGACTTCAAATCCGGTTGGGGCAGCGAGCCT
GTCCCGGGTGGGTTCGACCCCCACTCCCCTCCGCC
Downstream region at tRNA end position
Agcgctcacg
Secondary structure (Cloverleaf model)
>W1810671979	Sec	TCA
                   A      CGCC Agcgctcacg
                     G - C
                     G + T
                     A   C
                     A   C
                     G - C
                     G - C
                     G + T          C C
                    A     C A C C C     A
      C T C        A      | | | | |     G
    C       T G C T       G T G G G     C
    G       +     +                 T T
    G       G A C G
      T G G        G     TTGGGGCAGCGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK