The detailed information of tRNA gene sequence


Sequence ID>W1810677126
Genome IDQKMM01000005
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesNovosphingobium sp. B3058 49 (QKMM)
Start position on genome 258651
End posion on genome 258575
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
gcgaacctgg
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
aattttcaag
Secondary structure (Cloverleaf model)
>W1810677126	Met	CAT
                   g      ACCA aattttcaag
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK