The detailed information of tRNA gene sequence


Sequence ID>W1810696400
Genome IDQLTH01000005
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesEnsifer adhaerens AG1206 (QLTH)
Start position on genome 146214
End posion on genome 146310
Amino Acid Sec
Anticodon TCA
Upstream region at tRNA start position
tcagcgctgA
tRNA gene sequence
GGAAGGGAATCGTCTCCGGTGGGACGGCCGGACTTCAAATCCGGTTGGGGCAGCGAGCCT
GTCCCGGGTGGGTTCGACCCCCACTCCCCTCCGCC
Downstream region at tRNA end position
Agcgctcacg
Secondary structure (Cloverleaf model)
>W1810696400	Sec	TCA
                   A      CGCC Agcgctcacg
                     G - C
                     G + T
                     A   C
                     A   C
                     G - C
                     G - C
                     G + T          C C
                    A     C A C C C     A
      C T C        A      | | | | |     G
    C       T G C T       G T G G G     C
    G       +     +                 T T
    G       G A C G
      T G G        G     TTGGGGCAGCGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK