The detailed information of tRNA gene sequence


Sequence ID>W1810702169
Genome IDQMGE01000218
Search identical group
Phylum/ClassActinobacteria
SpeciesCellulomonas sp. K38 (QMGE)
Start position on genome 3500
End posion on genome 3571
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggacggtcgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCtc
Downstream region at tRNA end position
ccgaagggcc
Secondary structure (Cloverleaf model)
>W1810702169	Gly	CCC
                   c      TCtc ccgaagggcc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK