The detailed information of tRNA gene sequence


Sequence ID>W1810702214
Genome IDQMGF01000102
Search identical group
Phylum/ClassActinobacteria
SpeciesCellulomonas sp. K39 (QMGF)
Start position on genome 765
End posion on genome 836
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ccggcgccgc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCag
Downstream region at tRNA end position
cctgcgagag
Secondary structure (Cloverleaf model)
>W1810702214	Gly	CCC
                   c      TCag cctgcgagag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK