The detailed information of tRNA gene sequence


Sequence ID>W1810750747
Genome IDQOZU01000075
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus pantotrophus KS1 (QOZU)
Start position on genome 12721
End posion on genome 12636
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
aatgcccggc
tRNA gene sequence
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC
GGGTTCGAGTCCCGCCGCCCGCACCA
Downstream region at tRNA end position
tatccccccc
Secondary structure (Cloverleaf model)
>W1810750747	Leu	TAA
                   c      ACCA tatccccccc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G C G       G C G G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     GGGGCGCAAGCCTGT
                    T   T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK