The detailed information of tRNA gene sequence


Sequence ID>W1810757134
Genome IDQPGN01000008
Search identical group
Phylum/ClassActinobacteria
SpeciesBrachybacterium sp. JB7 (QPGN)
Start position on genome 149490
End posion on genome 149561
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
agggcgcttc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCtc
Downstream region at tRNA end position
tgagaaccgt
Secondary structure (Cloverleaf model)
>W1810757134	Gly	CCC
                   c      TCtc tgagaaccgt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK