Sequence ID | >W1810758354 |
Genome ID | QPIP01000068 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Cylisticus convexus of Cylisticus convexus Wcon [QPIP] |
Start position on genome | 8600 |
End posion on genome | 8672 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaaggtttat |
tRNA gene sequence |
TCCTCGGTAGCTCAGTGGTAGAGCAGTTGGCTGTTAACCAATTGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
tgatttctgt |
Secondary structure (Cloverleaf model) | >W1810758354 Asn GTT t GCgt tgatttctgt T - A C - G C - G T + G C - G G - C G - C T A T C G G C C A G A A | | + | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |