The detailed information of tRNA gene sequence


Sequence ID>W1810759484
Genome IDQPJL01000013
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus lutimaris CECT 8525 (QPJL)
Start position on genome 36504
End posion on genome 36419
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
aatccatggc
tRNA gene sequence
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC
GGGTTCGAGTCCCGCCGCCCGCACCA
Downstream region at tRNA end position
taattcagac
Secondary structure (Cloverleaf model)
>W1810759484	Leu	TAA
                   c      ACCA taattcagac
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G C G       G C G G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     GGGGCGCAAGCCTGT
                    T   T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK