The detailed information of tRNA gene sequence


Sequence ID>W1810759491
Genome IDQPJL01000020
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus lutimaris CECT 8525 (QPJL)
Start position on genome 40068
End posion on genome 40151
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
ggatgctcag
tRNA gene sequence
GCCCGAGTGGCGGAATGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGCATGTCG
GTTCGAGTCCGACCTCGGGTACCA
Downstream region at tRNA end position
ccgcaaaatc
Secondary structure (Cloverleaf model)
>W1810759491	Leu	CAA
                   g      ACCA ccgcaaaatc
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C          T G
                    T     C A G C C     A
      T A A        G      | | | | |     G
    G       G G C G       G T C G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     CGCCGCAAGGCAT
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK