The detailed information of tRNA gene sequence


Sequence ID>W1810762315
Genome IDQPML01000033
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus versutus MAL 1HM19 (QPML)
Start position on genome 28795
End posion on genome 28710
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
attccccggc
tRNA gene sequence
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC
GGGTTCGAGTCCCGCCGCCCGCACCA
Downstream region at tRNA end position
tattcccgca
Secondary structure (Cloverleaf model)
>W1810762315	Leu	TAA
                   c      ACCA tattcccgca
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G C G       G C G G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     GGGGCGCAAGCCTGT
                    T   T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK