The detailed information of tRNA gene sequence


Sequence ID>W1810783212
Genome IDQQSW01000007
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesChromatocurvus halotolerans DSM 23344 (QQSW)
Start position on genome 5456
End posion on genome 5381
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ccaagtttcc
tRNA gene sequence
GGGCCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGCTGGTTCGAAT
CCAGCACGGCCCACCA
Downstream region at tRNA end position
tttttccctt
Secondary structure (Cloverleaf model)
>W1810783212	Lys	TTT
                   c      ACCA tttttccctt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     T - A          T A
                    T     C G A C C     A
      T G A        A      | | | | |     G
    T       C T C G       G C T G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     TGGTC
                    G + T
                    T - A
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK