The detailed information of tRNA gene sequence


Sequence ID>W1810788259
Genome IDQREG01000005
Search identical group
Phylum/ClassBacteroidetes
SpeciesMarinoscillum furvescens DSM 4134 (QREG)
Start position on genome 255665
End posion on genome 255591
Amino Acid Asn
Anticodon GTT
Upstream region at tRNA start position
acgcaaatat
tRNA gene sequence
TCCTCAGTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCGTTGGTTCGAG
TCCAACCTGAGGAGCaa
Downstream region at tRNA end position
aagccactca
Secondary structure (Cloverleaf model)
>W1810788259	Asn	GTT
                   t      GCaa aagccactca
                     T - A
                     C - G
                     C - G
                     T - A
                     C - G
                     A - T
                     G - C          T G
                    T     C A A C C     A
      T G A        A      | | | | |     G
    T       C T C G       G T T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GGGTC
                    T - A
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    G T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK