The detailed information of tRNA gene sequence


Sequence ID>W1810789509
Genome IDQRGR01000024
Search identical group
Phylum/ClassBacteroidetes
SpeciesPontibacter diazotrophicus H4X (QRGR)
Start position on genome 66008
End posion on genome 65935
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gtagggagat
tRNA gene sequence
TGTCCGATGGTGTAACTGGCAACACGTCTGATTTTGGTTCAGAAGAGTCCAGGTTCGAGC
CCTGGTCGGACAACaa
Downstream region at tRNA end position
tcaaaagaac
Secondary structure (Cloverleaf model)
>W1810789509	Gln	TTG
                   t      ACaa tcaaaagaac
                     T - A
                     G - C
                     T - A
                     C - G
                     C - G
                     G - C
                     A - T          C G
                    T     G G T C C     A
      C A A        G      | | | | |     G
    T       T G T G       C C A G G     C
    G       | | | |                 T T
    G       A C A C
      C A          G     AGAGT
                    T - A
                    C - G
                    T - A
                    G - C
                    A - T
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK