The detailed information of tRNA gene sequence


Sequence ID>W1810862240
Genome IDQTUJ01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus bengalensis DSM 17099 (QTUJ)
Start position on genome 1165236
End posion on genome 1165163
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
tccgggcctc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
tccttccagg
Secondary structure (Cloverleaf model)
>W1810862240	Gly	CCC
                   c      TCCA tccttccagg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK