Sequence ID | >SRA1014113 |
Genome ID | SRR023845.4838 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 177 |
End posion on genome | 103 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gcggatttga |
tRNA gene sequence |
GCGGGTGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGGGTTCAAATC |
Downstream region at tRNA end position |
gtttccttaa |
Secondary structure (Cloverleaf model) | >SRA1014113 Gly GCC a TCCA gtttccttaa G - C C - G G - C G - C G - C T + G G - C T A T T T C C C A G A A + | | | | A G C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |