Sequence ID | >SRA1014122 |
Genome ID | SRR023845.9034 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 80 |
End posion on genome | 164 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
agccatttaa |
tRNA gene sequence |
GGGGCGGTGGCCGAGTGGTCTATGGCGACCGACTGTAAATCGGTTAGGGGAAGCCCTGCG |
Downstream region at tRNA end position |
aataaacggg |
Secondary structure (Cloverleaf model) | >SRA1014122 Tyr GTA a ACac aataaacggg G - C G - C G - C G - C C - G G - C G - C T A T C G T T C A T G A G | | | | | A G G C C G G C A A G C G + | | | T T T T G G C C T A G TAGGGGAAGCCCTGC A - T C - G C - G G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |