Sequence ID | >SRA1014134 |
Genome ID | SRR023845.13539 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 106 |
End posion on genome | 36 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
attttaataa |
tRNA gene sequence |
GCCAGATTAGTTTAGTGGTAAAACGGCTACCTTGTAAGTAGCAGTCCTGTGTTCAATTCA |
Downstream region at tRNA end position |
atatgcacca |
Secondary structure (Cloverleaf model) | >SRA1014134 Thr TGT a Aaac atatgcacca G + T C - G C - G A - T G + T A - T T - A T T T G G C A C A G A A | + | | | A T T T T G C T G T G C G | | | | T T G A A A C T A G AGTC G - C C - G T - A A - T C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |