Sequence ID | >SRA1014162 |
Genome ID | SRR023845.22748 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 27 |
End posion on genome | 98 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aattagttta |
tRNA gene sequence |
AATGATGTAGTTTAATGGTAGAGCGTGGGAATCATAATCCTAATGTTGTAGGTTCAAATC |
Downstream region at tRNA end position |
atttnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1014162 Met CAT a Ataa atttnnnnnn A - T A - T T - A G - C A - T T - A G - C T A T T A T C C A A A A + | | | | A T T T T G G T A G G C G + | + | T T G G A G C T A G ATGTT T - A G + T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |