Sequence ID | >SRA1014240 |
Genome ID | SRR023845.50503 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 182 |
End posion on genome | 108 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ataattttaT |
tRNA gene sequence |
TTCTTTGTAGCTCAATGGTAGAGCAAATGGCTGTTAACCAGTTAGGTTATAGGTTCAAAT |
Downstream region at tRNA end position |
ttttatttag |
Secondary structure (Cloverleaf model) | >SRA1014240 Asn GTT T GTtt ttttatttag T - A T - A C - G T - A T - A T - A G - C T A T T A T C C A A A A | | | | | A T C T C G A T A G G C G | | | | T T G G A G C T A A TAGGTT A - T A G T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |