Sequence ID | >SRA1014255 |
Genome ID | SRR023845.60319 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 128 |
End posion on genome | 202 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
caacagatac |
tRNA gene sequence |
AGGGGCGTCGCCAAGCGGTAAGGCAGCAGGTTTTGATCCTGCCATGCGTTGGTTCAAATC |
Downstream region at tRNA end position |
tttcttagat |
Secondary structure (Cloverleaf model) | >SRA1014255 Gln TTG c GCCA tttcttagat A - T G - C G - C G - C G - C C - G G - C T A T C G A C C A G A C | + | | | A C A C C G G T T G G C G | | | T T G A G G C T A A CATGC G - C C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |