Sequence ID | >SRA1014263 |
Genome ID | SRR023845.65739 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 246 |
End posion on genome | 170 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatcaacgat |
tRNA gene sequence |
GGGCTTGTAACTCAGTTGGTTAGAGTGCCTGACTCATAATCAGTAAGTCCCAGGTTCGAG |
Downstream region at tRNA end position |
acacgatcaa |
Secondary structure (Cloverleaf model) | >SRA1014263 Met CAT t ACGA acacgatcaa G - C G - C G - C C - G T + G T T G - C C G T G G T C C A T G A A | | | | | G T C T C A C C A G G C G | | | | T T G G A G T T T A G AAGTC C T C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |