Sequence ID | >SRA1014399 |
Genome ID | SRR023845.120783 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 50 |
End posion on genome | 123 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tggatgccgc |
tRNA gene sequence |
GGGCCTCTAGCTCAGTTGGCAGAGCAGCGGACTTTTAATCCGCGGGTCGTCGGTTCGAGC |
Downstream region at tRNA end position |
ctcccgccgt |
Secondary structure (Cloverleaf model) | >SRA1014399 Lys TTT c ACtc ctcccgccgt G - C G - C G - C C - G C - G T + G C - G C G T C A G C C A T G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C C A A GGGTC G - C C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |